by Dr. Barry Starr, Stanford University

Q:   What are chromosomes made of? Where are the 23 pairs of chromosomes located in the DNA?

A:   Chromosomes are made of DNA.  Think of our DNA as a 6 foot long molecule cut into 46 pieces.  Each piece is a chromosome.

Q:  So, what is the difference between a chromosome, a gene, a protein and DNA? I mean where do they all fit in?



A:
With words like these being bandied about willy-nilly, it isn’t surprising that you are a bit confused by all of this. Here is a breakdown of what each means and how they relate.

Stanford University Medical School, by Dr. Barry Starr  —  DNA is the chemical that chromosomes and genes are made of. DNA itself is made up of four simple chemical units that are abbreviated as A, G, C, and T. These letters are used to form three letter words that cells can read.

A chromosome is simply a very long piece of DNA that cells can easily copy. Humans usually have 23 pairs of chromosomes. They are numbered 1-22 with the 23rd pair being either XX in girls or XY in boys.

A gene is a stretch of DNA on a chromosome that has the instructions for making a protein. Each chromosome has many genes with humans having over 22,000 genes in all. A gene’s instructions for a protein are written in the three letter code I referred to before.

A protein is a molecular machine that does a specific job. Some proteins like amylase help us digest food. Others like opsins help us see colors. And still others like the globins help our blood take oxygen to and carbon dioxide away from our cells.

Beta Globin (Hemoglobin)

Let’s look at the HBB gene and the beta globin protein as an example to make this all more concrete. From here on out, I will call beta globin by its more common name, hemoglobin.

The hemoglobin gene, HBB, is found on chromosome 11. This chromosome is a little less than 135 million DNA letters long and HBB is just one of its over 1500 different genes. Chromosome 11 is definitely one of the most gene-rich chromosomes we have.

Near the middle of this chromosome is 1600 or so DNA letters that together make up the HBB gene. The actual instructions for making hemoglobin are found in 444 letters within this 1600 letter stretch. (The other letters are used to figure out when, where, and how much of the protein to make.)

A quick summary up to this point. Human DNA consists of around 3 billion DNA letters. Around 4.5% of this is chromosome 11. And around 0.000015% of human DNA has the the instructions for hemoglobin.

The instructions for hemoglobin are written in the three letter words (or codons) I talked about earlier. To understand how these codons work, I need to give a brief description of what a protein is.

The genetic alphabet has 4 letters. The genetic language is made of 64 three letter words

Proteins are strings of amino acids stuck together. The number and particular order of the 20 different amino acids determines what a protein can do. Proteins can range anywhere from 34,350 amino acids in the muscle protein titin to less than 100 amino acids in proteins like insulin.

As I said, the instructions for putting a protein together are found in the codons of a gene. Each codon tells the cell which amino acid to add to the protein.

For example, the 444 DNA letters of the HBB gene that tells the cell how to make hemoglobin starts out like this:

ATGGTGCATCTGACTCCTGAGGAG…

To make things easier, we’ll split this up into three letter words:

ATG GTG CAT CTG ACT CCT GAG GAG…

Each of these codons tells a cell which amino acid to add. For example, an ATG tells the cell to add a methionine (or Met). So, like most other proteins, hemoglobin starts out with Met. Next comes a valine (Val), then a leucine (Leu), etc. When we keep adding amino acids we end up with the following:

Met-Val-Leu-Thr-Pro-Glu-Glu…

This goes on for another 141 amino acids and you have hemoglobin.

Hemoglobin is a critical protein in our blood. It carries oxygen to and carbon dioxide away from cells. We need for the amino acids to be put together just right or we can end up with a disease. Like sickle cell anemia.

One DNA letter difference causes these cells to sickle.

Sickle cell anemia is a disease that affects around 72,000 people in the U.S. Most of these folks have ancestors who came from Africa. (Click here to find out why it is so common in people of African descent.)

People with sickle cell anemia have a single difference in the 444 letters of their hemoglobin gene instructions. Their gene starts out with:

ATG GTG CAT CTG ACT CCT GTG GAG…

This means that their hemoglobin protein starts out with:

Met-Val-Leu-Thr-Pro-Val-Glu…

This one difference is enough to cause sickle cell anemia! In other words, a difference of 1 out of 3 billion letters can cause the problems of sickle cell anemia. Similar small changes in other genes can cause problems like cystic fibrosis, dwarfism, etc.

So there you have it. Genes and chromosomes are made up of the 4 letters of DNA. And cells read the letters found in stretches of DNA called genes to make proteins that help our bodies and minds run properly.

Very 60’s video explaining going from RNA to proteins.

Q:   Are cells designed to only work with specific DNA types? For example, can human DNA work in a tomato cell? If not, why not?
A:   What an interesting question. There are a number of different answers depending on what you mean by human DNA.

If you put all of a human’s DNA into a plant cell, it wouldn’t work. And a single human gene wouldn’t work either. But if you connected part of a human gene to part of a plant gene, then you might get a tomato cell to use this hybrid creation.

One of the big reasons why plant cells have such a hard time with human DNA is they can’t pick the genes out of it. If the plant cells could find the genes, then they could use them. But they can’t.

Now, even if a plant cell could find and use all the human genes in human DNA, this plant/human cell would probably still die. The human DNA would almost certainly not be able to support parts of the plant cell like the mitochondria or chloroplast. And cells need these organelles to live.

These are the major reasons why human DNA wouldn’t work in a tomato cell. There are other, more subtle reasons too but I won’t have time to go into those.

What I will have time for is to go into a bit more detail about the two main reasons human DNA won’t work in a tomato (or a frog or a chicken for that matter). To do this, we’ll first need to go over a bit about what genes are. And how they work.

Genes are Instructions for Proteins

As you probably already know, human DNA has the instructions for making a human. And tomato DNA has the instructions for making a tomato. A lot of these instructions are found in the form of genes.

Genes are long chunks of DNA that have the instructions for doing one specific thing in a cell. You are the end result of 25,000 or so different genes all working together.

Each gene actually has the instructions for making a certain protein. It is this protein that goes on to do something specific in a cell. To summarize, genes make proteins and proteins do the work.

The instructions in the gene for making the protein are written in a genetic code. Pretty much all living things use nearly the same code. So this part of a gene from humans can be read in plants, animals, whatever. But most of these organisms couldn’t find this part of a gene in human DNA.

Identifying a Gene

Most of a plant’s or a human’s DNA isn’t made of genes at all. This means a cell has to be able to pick out which bits of DNA to read and make into proteins.

If a cell picks the wrong chunk of DNA, it’ll waste its time and energy making a bit of gibberish. Too much gibberish and the cell will die.

So it is very important for a cell to be able to find the right piece of DNA to read. It is also very important that a cell read the right protein at the right time.

If you were a tomato, you wouldn’t want to turn on a leaf gene in your roots. And if you’re a person, you don’t want hair growing out of your lungs.

Cells have set up very complicated systems to control how, when, and where genes are read. And the systems from different beasts have their own unique features. The further away two living things are from each other in evolutionary terms, the less likely they are to recognize each other’s genes.

A plant has a very different system for identifying and controlling a gene compared to an animal. And so does a bacterium, a mushroom, or a Paramecium.

Human DNA in Tomatoes

What this means is that a plant cell can’t tell where a human gene starts and vice versa. This is why if you put a human gene into a tomato cell, it is very unlikely to work.

Obviously then, if you replaced all of a tomato’s DNA with a human’s, the tomato cell wouldn’t be able to tell where the genes were either. The cell would eventually wither and die.

But if you put the instructions for a human protein in the midst of plant gene recognition DNA, then the human protein would get made. By mixing and matching DNAs, you can get a tomato to make a human protein.

So that’s your answer for tomato and human DNA. But a human and a tomato cell are pretty far apart. What about human DNA in a frog, moose, or chicken cell? Or tomato DNA in a redwood or a wheat plant?

These are unlikely to work either. A big reason why is that human DNA can’t support some of the frog or chicken cellular machinery.

Chloroplasts and Mitochondria

Most of a cell’s DNA is squirreled away in a compartment called the nucleus. A bit of your DNA is also found in something called a mitochondrion. Mitochondria are where a cell gets most of its energy.

If current theories hold true, mitochondria used to be free living. This is why they have their own DNA.

Around a billion or so years ago, our ancestors engulfed these free living creatures and put them to work. Thus was born one of the most successful duos ever—the eukaryote.

Over time, the mitochondrial DNA has become smaller and smaller. Now this “lost” DNA hasn’t disappeared…a mitochondrion still needs it to work. This DNA has instead migrated to the nucleus where it still lives today.

This matters for our discussion because the mitochondria of different living things have had different bits of their DNA migrate. In other words, the mitochondria of each kind of organism have a different subset of genes. The nuclear DNA of a human almost certainly does not have what a frog mitochondrion has lost to a frog nucleus over time.

So even if a frog cell could read the human DNA, the hybrid cell would still die. The frog mitochondria would stop working because it is missing key mitochondrial genes that the human DNA does not have. No mitochondria=no energy=death.

The same sort of thing works for chloroplasts too. Chloroplasts are how plants use sunlight to make sugar for energy.

Chloroplasts have their own DNA because they used to be free living too. And their DNA has been whittled down differently in different plants just like in mitochondria.

Tomato DNA could not support wheat mitochondria or chloroplasts. The tomato/wheat cell would die from lack of energy just like the frog/human cell.

These are the major reasons why human DNA wouldn’t be able to run a tomato or frog cell. And, on a side note, why genetic engineering is so tricky!

You can’t just put a human gene into a tomato…you need to monkey with it to get the gene to work there. The same thing goes for an insulin gene in bacteria or a human gene in a cow.

http://www.thetech.org/genetics/ask.php?id=293

click for more genetic info

Medscape.com, November 16, 2010, by Sue Hughes, (Oxford, United Kingdom and Sydney, Australia) — Further reductions in LDL cholesterol with more intensive statin regimens safely produce definite further reductions in vascular events, even down to very low LDL levels, lower than current targets, results of two new meta-analyses show [1]. There was no evidence of any lower threshold where the benefit is not seen.

The two meta-analyses, published online in the Lancet today, were conducted by the Cholesterol Treatment Trialists’ (CTT) Collaboration, which includes researchers from both University of Oxford, UK, and the National Health and Medical Research Council Clinical Trials Centre (CTC) at the University of Sydney, Australia.

Beneficial Right Down to 1.3 mmol/L (50 mg/dL)

Lead author of the studies, Dr Colin Baigent (University of Oxford), told heartwire that these results “added substantially” to current knowledge in showing that reducing LDL well below current targets is beneficial. “By combining individual patient data from all the statin studies, we have a large group of people who started at the current LDL target level of 1.8 mmol/L (70 mg/dL) and got down to levels of around 1.3 mmol/L (around 50 mg/dL), and this group also showed a definite reduction in vascular events. This has not been shown before.”

He noted, however, that these figures applied to patients at high risk of cardiovascular disease. “I would say anyone with a risk of cardiovascular disease greater than 2% per annum should be lowering their LDL as much as possible. This will give them massive benefits, without any hazard. The relative risk reductions will also probably be there in lower-risk patients, but the absolute risk will be much smaller, so we are not advocating that as a public-health strategy in low-risk groups.”

The researchers conclude: “Each 1-mmol/L LDL cholesterol reduction reduces the risk of occlusive vascular events by about a fifth, irrespective of baseline cholesterol concentration, which implies that a 2- to 3-mmol/L reduction would reduce risk by about 40% to 50%. These findings suggest that the primary goal for patients at high risk of occlusive vascular events should be to achieve the largest LDL-cholesterol reduction possible without materially increasing myopathy risk.”

They add that in contrast to current therapeutic guidelines, which tend to emphasize particular LDL-cholesterol targets, these new results suggest that lowering of LDL cholesterol further in high-risk patients who achieve such targets would produce additional benefits, without an increased risk of cancer or nonvascular mortality.

They also suggest that rather than using 80 mg of generic simvastatin to achieve these benefits, the more potent statins such as 80-mg atorvastatin or 20-mg rosuvastatin may be a better approach to avoid myopathy.

Commenting on the meta-analysis for heart wire , Dr Christie Ballantyne (Baylor College of Medicine, Houston, TX) said: “I agree in general that lower is better and that simvastatin 80 mg is not as good a choice as atorvastatin 80 mg or rosuvastatin 20 mg, which have better safety profiles and greater efficacy.”

Data From a Total of 170 000 Patients

The first meta-analysis combined individual patient data from five trials of more vs less intensive statin therapy. Overall, among the 39 612 participants, mean baseline LDL was 2.53 mmol/L. During the 5.1-year mean follow-up, first major vascular events (coronary death, MI, coronary revascularization, or stroke) occurred at a rate of in 4.5% per annum in the more intensive treatment group vs 5.3% per annum in those allocated to less intensive therapy, a highly significant further proportional risk reduction of 15% per year with an LDL reduction of 0.51 mmol/L. This corresponds to a mean risk reduction of 28% per 1.0-mmol reduction in LDL.

For the second analysis, the researchers updated a previous meta-analysis with individual patient data from new trials, with a total of 21 trials of statin vs control involving 129 526 patients. In this analysis, mean baseline LDL cholesterol was 3.70 mmol/L. After a mean follow-up of 4.8 years, results showed a rate of first major vascular events of 2.8% per annum in the statin patients vs 3.6% per annum in the control patients, corresponding to a highly significant 22% risk reduction per year with a 1.07-mmol/L LDL reduction. This corresponds to a mean 21% risk reduction per 1.0-mmol/L reduction in LDL.

After differences in the absolute reductions in LDL cholesterol were accounted for, the proportional reduction in the incidence of major vascular events per mmol/L was slightly larger in the trials of more vs less intensive therapy than in those of statin vs control. Taking all 26 trials together, the risk reduction was 22%.

Question Over Hemorrhagic Stroke

There was no significant evidence in the meta-analysis of trials of more vs less intensive therapy that further lowering of LDL cholesterol produced any adverse effects, even in participants with baseline LDL cholesterol lower than 2.0 mmol/L, with no increase in nonvascular mortality or site-specific cancer incidence.

The one adverse effect that may be of concern with lower cholesterol level is hemorrhagic stroke. In the present meta-analyses, which included nearly 500 confirmed hemorrhagic strokes, lowering of LDL cholesterol with statin therapy was associated with a nonsignificant excess (257 vs 220; p=0.2). The authors point out that in two trials unavailable for this meta-analysis (SPARCL and CORONA), there were more hemorrhagic strokes in the statin group, and if these events were included in the meta-analysis then this would give a significant excess (hazard ratio 1.21; p=0.01) per 1.0-mmol/L LDL-cholesterol reduction. But they add that the size of the potential hazard would be about 50 times smaller (perhaps a few extra hemorrhagic strokes annually per 10 000 treated) than the definite absolute benefits (a few hundred occlusive events avoided annually per 10 000 treated) for patients who are at high risk of occlusive vascular events.

Numbers More Persuasive in Patients at High Cardiovascular Risk

In an accompanying editorial [2], Drs Bernard Cheung and Karen Lam (University of Hong Kong) note that as epidemiological data suggest that there is a log–linear association between cholesterol concentration and cardiovascular risk, with no flattening of the curve at low concentrations of cholesterol, and “therefore a tempting option is to decrease LDL-cholesterol concentration as much as possible.”

But they point out that clinical benefit depends more on the absolute risk reduction or the number needed to treat than on relative risk reduction, and they conclude: “A low baseline LDL concentration is not a reason to withhold statin therapy if the patient is at a definite risk of cardiovascular events (eg, secondary prevention or diabetes). In this setting, the absolute risk reduction, number needed to treat, and risk/benefit and cost/benefit ratios are favorable. These numbers will be less persuasive for people at low cardiovascular risk, such as young people with no risk factors. At the population level, statins are underused, so the urgent priority is to identify people who would benefit most from statin therapy and to lower their LDL cholesterol aggressively, with the more potent statins if necessary.”

SEARCH Lipid Arm Published

Also published along with the two meta-analyses is the lipid arm of the SEARCH trial, which was first presented at the 2008 American Heart Association meeting [3]. In this study, 2064 patients with a history of MI were randomized to either 80-mg or 20-mg simvastatin daily. Results showed that the more intensive lipid-lowering arm produced a further 0.35-mmol/L reduction in LDL cholesterol, which translated into a nonsignificant 6% proportional reduction in vascular events. These occurred in 24.5% of the 80-mg group vs 25.7% in the 20-mg group (risk ratio 0.94, 95% CI 0.88–1.01; p=0.10). Myopathy was increased with the 80-mg simvastatin dose. Compared with two (0.03%) cases of myopathy in patients taking 20-mg simvastatin daily, there were 53 (0.9%) cases in the 80-mg group. This is one of the five trials of more vs less intensive statin therapy included in the current meta-analysis.

The carrier of dengue fever is the mosquito Aedes aegypti feeding from a human host

FORBES.com, GoogleNews.com, November 15, 2010, by Juliana Barbassa, RIO DE JANEIRO — Health officials say that Brazil is at risk of an even deadlier outbreak of dengue fever as the South American nation enters its long, wet summer, when standing water turns into breeding ponds for the mosquitoes that spread the disease.

The country saw a dramatic spike in the number of fatal cases this year: 592 were recorded from January through October, an increase of 90 percent over the 312 dengue deaths recorded during the same period last year, according to figures released Thursday by the Ministry of Health.

And the resurgence of the Type 1 dengue strain largely absent in Brazil since the 1990s means that cases could continue to rise, officials say, stretching an overtaxed health care system.

When the six-month rainy season starts in December, the frequent downpours will quickly turn trash piles, old tires, abandoned wells and even crumpled cigarette packs into containers of stagnant water where mosquitoes can breed.

Luis Fernando Moraes, president of the Regional Council of Medicine of Rio de Janeiro, said the risk is particularly high for children who have never been exposed to the resurgent Type 1 strain of the disease and thus have low resistance to it.

Exposure to a single strain of the disease helps develop immunity to that particular variant, but subsequent infection by a different strain can cause the sometimes fatal hemorrhagic dengue.

Symptoms of dengue include flulike conditions such as high fever, headaches, and severe muscle and joint pain. The health ministry has registered about 940,000 cases of dengue so far in 2010, nearly double last year’s total. Treatment options are few, and a potential vaccine is still in testing and not available to the public.

A health ministry report said the states most at risk include Rio de Janeiro, where the recent closure of a major suburban hospital and the scheduled shuttering of two more has raised concerns that there might not be enough medical resources to deal with an epidemic.

“There is huge concern with the arrival of summer,” Moraes said. “We could face a difficult situation in which our overburdened health care system would be stretched even further.”

Brazil has worked hard to fight the disease within its own borders and help neighboring countries, said Dan Epstein, a spokesman with the World Health Organization in Washington, D.C.

The government is campaigning to educate the public to prevent water from pooling, but getting word to the sprawling country’s remote areas is tough, Epstein said.

“The weather and circumstances make for perfect breeding ground for Aedes aegypti mosquitoes,” he said.

The WHO estimates that more than 2.5 billion people worldwide are at risk for dengue, and at least 50 million are sickened each year.

“It’s a serious problem in the Americas and globally, particularly in Southeast Asia,” Epstein said. “It’s one of the serious neglected diseases affecting tropical countries, and one of the things we have make a priority.”

Dengue fever (pronounced dɛŋɡeɪ| UK, dɛŋɡi|US) and dengue hemorrhagic fever (DHF) are acute febrile diseases transmitted by mosquitoes, which occur in the tropics, can be life-threatening, and are caused by four closely related virus serotypes of the genus Flavivirus, family Flaviviridae. It was identified and named in 1779. It is also known as breakbone fever, since it can be extremely painful.

Unlike malaria, dengue is just as prevalent in the urban districts of its range as in rural areas. Each serotype is sufficiently different that there is no cross-protection and epidemics caused by multiple serotypes (hyperendemicity) can occur. Dengue is transmitted to humans by the Aedes (Stegomyia) aegypti or more rarely the Aedes albopictus mosquito. The mosquitoes that spread dengue usually bite at dusk and dawn but may bite at any time during the day, especially indoors, in shady areas, or when the weather is cloudy. The WHO says some 2.5 billion people, two fifths of the world’s population, are now at risk from dengue and estimates that there may be 50 million cases of dengue infection worldwide every year. The disease is now endemic in more than 100 countries.

There is an ongoing 2010 outbreak occurring in Puerto Rico with 5382 confirmed infections and 20 deaths.There is also an ongoing outbreak occurring in Pakistan with more than 5000 confirmed infections and death toll rose to 31. In 2010 and 2009 there were dengue outbreaks in Key West Florida

Symptoms of Dengue Fever

The diagnosis of dengue is usually made clinically. The classic picture is high fever with no localising source of infection, a rash with thrombocytopenia and relative leukopenia – low platelet and white blood cell count. Dengue infection can affect many organs and thus may present unusually as liver dysfunction, renal impairment, meningo-encephalitis or gastroenteritis.

  1. Fever, headaches, eye pain, severe dizziness and loss of appetite.
  2. Hemorrhagic tendency (positive tourniquet test, spontaneous bruising, bleeding from mucosa, gingiva, injection sites, etc.; vomiting blood, or bloody diarrhea)
  3. Thrombocytopenia (<100,000 platelets per mm³ or estimated as less than 3 platelets per high power field)
  4. Evidence of plasma leakage (hematocrit more than 20% higher than expected, or drop in hematocrit of 20% or more from baseline following IV fluid, pleural effusion, ascites, hypoproteinemia)
  5. Encephalitic occurrences.

Dengue shock syndrome is defined as dengue hemorrhagic fever plus:

  • Weak rapid pulse,
  • Narrow pulse pressure (less than 20 mm Hg)
  • Cold, clammy skin and restlessness.

Dependable, immediate diagnosis of dengue can be performed in rural areas by the use of Rapid Diagnostic Test kits, which also differentiate between primary and secondary dengue infections. Serology and polymerase chain reaction (PCR) studies are available to confirm the diagnosis of dengue if clinically indicated. Dengue can be a life threatening fever.

One test is called Platelia Dengue NS1 Ag assay, or NS1 antigen test for short, made by Bio-Rad Laboratories and Pasteur Institute, introduced in 2006, allows rapid detection before antibodies appear the first day of fever.

In India, the diagnosis of dengue may take up to a week. The introduction of PCR (NS1) in September 2010 cut short the waiting time to 48 hours. It costs approximately 1,600 rupees.[18]

In many poverty stricken areas, a diagnosis may be too expensive and/or meaningless (given there is no cure, only supportive therapy) so significant under-reporting is expected to be the norm.

The mainstay of treatment is timely supportive therapy to tackle circulatory shock due to hemoconcentration and bleeding. Close monitoring of vital signs in the critical period (up to 2 days after defervescence – the departure or subsiding of a fever) is critical. Oral rehydration therapy is recommended to prevent dehydration in moderate to severe cases. Supplementation with intravenous fluids may be necessary to prevent dehydration and significant concentration of the blood if the patient is unable to maintain oral intake. A platelet transfusion may be indicated if the platelet level drops significantly (below 20,000) or if there is significant bleeding. The presence of melena may indicate internal gastrointestinal bleeding requiring platelet and/or red blood cell transfusion.

Aspirin and non-steroidal anti-inflammatory drugs should be avoided as these drugs may worsen the bleeding tendency associated with some of these infections. All kinds of Intramuscular injections are contraindicated. Patients may receive paracetamol, acetaminophen, preparations to deal with these symptoms if dengue is suspected.

There is no tested and approved vaccine for the dengue flavivirus. There are many ongoing vaccine development programs.

http://www.righthealth.com/topic/Dengue_Fever_Photos?p=l&as=goog&ac=519&kgl=35523293#ixzz157C4al8y